Abstract
The p53 mutants 248Trp, 175His. and 281Gly fail to activate transcrip tion mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chronic myelogenous leukemia cells. The p53 mutants enhanced the p53CON-mediated gene expression of wild-type p53 but decreased the wild-type p53-activated transcription mediated by ribosomal gene cluster. Thus, p53CON and ribosomal gene cluster represent distinct p53-binding elements. Furthermore, p53 mutants may affect the transcriptional activ ity of wild-type p53 in either a dominant positive or a dominant negative manner, depending on the binding element present.
Original language | English (US) |
---|---|
Pages (from-to) | 4772-4775 |
Number of pages | 4 |
Journal | Cancer research |
Volume | 53 |
Issue number | 20 |
State | Published - Oct 1993 |
ASJC Scopus subject areas
- Oncology
- Cancer Research