Novel DNA binding of p53 mutants and their role in transcriptional activation

W. Zhang, W. D. Funk, W. E. Wright, J. W. Shay, A. B. Deisseroth

Research output: Contribution to journalArticlepeer-review

61 Scopus citations

Abstract

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg→Trp) and 281 (Asp→Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val→Ala) and 273 (Arg→His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg→His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

Original languageEnglish (US)
Pages (from-to)2555-2559
Number of pages5
JournalOncogene
Volume8
Issue number9
StatePublished - 1993

ASJC Scopus subject areas

  • Molecular Biology
  • Genetics
  • Cancer Research

Fingerprint Dive into the research topics of 'Novel DNA binding of p53 mutants and their role in transcriptional activation'. Together they form a unique fingerprint.

Cite this