@article{01c9ca33039040a59f0a4cc31a7bb2d6,
title = "TAM Kinases Promote Necroptosis by Regulating Oligomerization of MLKL",
abstract = "Necroptosis, a cell death pathway mediated by the RIPK1-RIPK3-MLKL signaling cascade downstream of tumor necrosis factor α (TNF-α), has been implicated in many inflammatory diseases. Members of the TAM (Tyro3, Axl, and Mer) family of receptor tyrosine kinases are known for their anti-apoptotic, oncogenic, and anti-inflammatory roles. Here, we identify an unexpected role of TAM kinases as promoters of necroptosis, a pro-inflammatory necrotic cell death. Pharmacologic or genetic targeting of TAM kinases results in a potent inhibition of necroptotic death in various cellular models. We identify phosphorylation of MLKL Tyr376 as a direct point of input from TAM kinases into the necroptosis signaling. The oligomerization of MLKL, but not its membranal translocation or phosphorylation by RIPK3, is controlled by TAM kinases. Importantly, both knockout and inhibition of TAM kinases protect mice from systemic inflammatory response syndrome. In conclusion, this study discovers that immunosuppressant TAM kinases are promoters of pro-inflammatory necroptosis, shedding light on the biological complexity of the regulation of inflammation. TAM kinases are known for their oncogenic, anti-apoptotic, and anti-inflammatory roles. Najafov et al. discover an unexpected role for TAM kinases in mediating necroptosis, a pro-inflammatory programmed necrotic cell death. Mechanistic studies reveal that TAM kinases phosphorylate MLKL and promote its oligomerization, a step that forms a cell-membrane-rupturing pore.",
keywords = "Axl, MLKL, Mer, TAM kinases, Tyro3, cell death, necroptosis",
author = "Ayaz Najafov and Mookhtiar, {Adnan K.} and Luu, {Hoang Son} and A. Ordureau and Heling Pan and Amin, {Palak P.} and Ying Li and Qingxian Lu and Junying Yuan",
note = "Funding Information: We thank The Nikon Imaging Center at Harvard Medical School for assistance with microscopy and the Taplin Mass Spectrometry Core Facility at Harvard Medical School for mass spec analysis. This work was supported in part by funding from the Ludwig Center at Harvard Medical School. The work of H.P. and Y.L. was supported by the Chinese Academy of Sciences. A.N. and J.Y. conceived and coordinated the project, designed the experiments, interpreted the data, and wrote the manuscript. A.N. performed most of the experiments. A.K.M. H.S.L. A.O. P.P.A. Y.L. and Q.L. assisted with experiments and provided reagents. H.P. raised and tested the MLKL phospho-Tyr376 rabbit polyclonal, MLKL mouse monoclonal, and RIPK3 mouse monoclonal antibodies. A.K.M. performed animal husbandry, genotyping, and mouse injections. J.Y. is a consultant of Denali Therapeutics. A.N. and J.Y. have filed a patent application including results from this study. Funding Information: We thank The Nikon Imaging Center at Harvard Medical School for assistance with microscopy and the Taplin Mass Spectrometry Core Facility at Harvard Medical School for mass spec analysis. This work was supported in part by funding from the Ludwig Center at Harvard Medical School . The work of H.P. and Y.L. was supported by the Chinese Academy of Sciences . Funding Information: RNA was isolated from HEK293 and HeLa cells using RNeasy kit (QIAGEN) and cDNA synthesis was performed using SuperScript II Reverse Transcriptase (Life Technologies) or using RNA to cDNA EcoDry Premix (Double Primed) (Takara Bio). Molecular cloning was performed using New England Biolabs restriction enzymes and T4 DNA ligase. Plasmids were transformed into in-house-generated chemically-competent DH5α E. coli cells. Plasmid purifications and extractions were performed using QIAprep Spin Miniprep Kit (QIAGEN) and QIAquick Gel Extraction Kit (QIAGEN). sgRNA sequences, used for generation of CRISPR/Cas9-mediated knockout cell lines, were cloned into pX459-puro vector (Addgene). sgRNA sequences were hTyro3: GACAGTGTCTCAGGGGCAGC; hMLKL: CGTCTAGGAAACCGTGTGCA. HT-29 cells were transfected with pX459-puro-sgRNA plasmids using Lipofectamine 2000, according to manufacturer{\textquoteright}s protocol, and 48 hours post-transfection were switched to McCoy{\textquoteright}s medium containing 2 μg/ml puromycin, for 7 days. Individual clones were picked and analyzed by western blotting and sequencing for loss of expression and in-dels, respectively. Sequencing reactions were carried out with an ABI3730xl DNA analyzer at the DNA Resource Core of Dana-Farber/Harvard Cancer Center (funded in part by NCI Cancer Center support grant 2P30CA006516-48). Lipofectamine RNAiMAX (Life Technologies) was used for transfection of siRNA as per manufacturer{\textquoteright}s protocol. Tyro3 siRNA oligos used for knockdown experiments were: GCAGACGCCAUAUGCUGGCAUUGAA and AACAAGUUUGGCCACGUGUGGAUGG. Publisher Copyright: {\textcopyright} 2019 Elsevier Inc.",
year = "2019",
month = aug,
day = "8",
doi = "10.1016/j.molcel.2019.05.022",
language = "English (US)",
volume = "75",
pages = "457--468.e4",
journal = "Molecular cell",
issn = "1097-2765",
publisher = "Cell Press",
number = "3",
}